univerge site banner
Original Article | Open Access | Am. J. Pure Appl. Sci., 2024; 6(3), 73-83 | doi: 10.34104/ajpab.024.073083

Isolation and Molecular Detection of Bacteria Causing Omphalitis in Poultry with Look on Antibiotic and Disinfectant Resistance

Md. Tajkirul Hasan Mail Img ,
Zakaria Ahmed Sany Mail Img Orcid Img ,
Saifullah Mansur Mail Img ,
Md. Faishal Ahmed Mail Img ,
Faiz Arafat Maksud Mail Img ,
Sumaiya Khatun Mail Img ,
Nazmi Ara Rumi* Mail Img Orcid Img ,
Farzana Afroz Mail Img ,
Md. Aoulad Hosen Mail Img Orcid Img

Abstract

Antimicrobial resistance is an international concern and creates critical health issues for both humans and animals. This research aimed to ascertain the prevalence of isolates, antibiotic, and disinfectant resistance patterns from omphalitis suspected chicks in Dinajpur, Bangladesh. A total of 24 yolk swab samples were collected from different hatcheries for microbiological analysis and antibiotic sensitivity tests. The PCR employing 16s and 23s RNA genes was conducted to detect Escherichia coli invA genes were used to detect Salmonella spp. and 23S rRNA genes were applied for Staphylococcus spp. A total of 35 isolates were identified where 14 (40%) E. coli, 10 (28.58%) Salmonella spp., and 11 (31.42%) Staphylococcus spp. from day 1-8, respectively. The largest amount of bacteria on day 5, including day 7 (20%), followed by days 3, 4, and 6, including 6 (17.14%) observed, respectively. The PCR band of E. coli was detected at 232 bp, Salmonella spp. 284 bp and Staphylococcus spp. 1267 bp respectively. E. coli was highly resistant to Amoxicillin (100%), followed by Tetracycline (83.33%), whereas highly sensitive to cefotaxime (100%), Gentamicin and Co-trimoxazole (83.33%). Salmonella spp. indicates high susceptibility to Cefotaxime, Co-trimoxazole, and Ceftazidime (83.33%), followed by Gentamicin (66.67%) respectively, whereas Staphylococcus spp. was found to be highly resistant to Methicillin (100%) and Ampicillin (100%) followed by Gentamicin and Tetracycline (83.33%) respectively. The MAR index calculation of isolated E. coli, Salmonella spp., and Staphylococcus spp. from different sources of poultry hatcheries was measured at 0.77, 0.79, and 0.77, which affect the newly hatched chicks in poultry industries. Therefore, an urgent surveillance program is needed to fight antimicrobial resistance in poultry production sectors in Bangladesh.

INTRODUCTION

Omphalitis is an infectious and non-contagious condition of yolk sac accompanied by unhealed navels in chicks. According to Abdel-Tawab et al. (2016), exaggerated chicks appear normal, right up to a few hours before they pass away. Yolk sac infection caused chick mortality during the first week of the post-hatching (Abdel-Tawab et al., 2016). Chicken is the most economical source of animal protein in the comparison with red meat, particularly in developing countries, global broiler production exceeded 100.5 million tons in 2021 and is expected to further increase by 2% in 2022 (Saad et al., 2023). Pathogenic bacteria are the primary causes of poultry diseases worldwide; they are responsible for the most significant economic losses resulting in a huge annual financial loss exceeding 50 billion USD (Rahman et al., 2019; Saad et al., 2023). 

The poultry industry is the important economic sector in Bangladesh and the largest food supplier to the global population. The development of the poultry industry in Bangladesh has increased and is driven by the high market demand for poultry commodities. Many bacterial isolates are responsible for navel illness including Proteus spp., Enterobacter spp., Pseudomonas spp., Klebsiella spp., Staphylococcus spp., Streptococcus spp., Clostridium spp., Bacillus cereus and Enterococcus spp. were isolated from yolk sac in chicks in different locations all over the world (Abdel-Tawab et al., 2016). In previous research several researchers identified Escherichia coli (Eaea) virulence gene, Salmonella invasion (invA) gene and Staphylococcus (MRSA) gene (Abdel-Tawab et al., 2016. All enterprises involved in animal farming, especially chicken farming, are frequently vulnerable to disease. As such, data and understanding regarding the prevalence of diseases as well as initiatives to stop, manage, and completely eradicate them are crucial (Shahen et al., 2019; Wibisono et al., 2022). 

Antimicrobial resistance, especially MDR, is a difficult problem to overcome when treating infectious diseases (Wibisono et al., 2022). The qacED1 gene was found to be present in isolated E. coli with a 100% incidence rate in the previous investigation that looked for disinfectant-resistant genes in unhatched chicken eggs in Egypt (Ibrahim et al., 2019). The study explains why antibiotics fail to treat E. coli infections in poultry and increase the infection rate in the first week of life. Antibiotic resistance is common in poultry farms and the environment and can spread to humans via food or water. Very few researches were conducted to identify disinfectant and antibiotic resistance genes of different bacterial isolates from omphalitis infected chicks in Bangladesh. These antibiotic resistance genes are very harmful for broiler chickens as well as human health. Drug resistance is becoming a growing threat to public health, and the environment, it also induced therapeutic failure and economic losses in animal production. Therefore, the aim of this research was to investigate the incidence, investigate antibiotic and disinfectant resistance isolates from yolk sack of suspected chicken omphalitis, as well as detect specific resistance gene by molecular detection method (PCR).

MATERIALS AND METHODS

Study area and yolk swab sampling 

In this study, 24 yolk swab samples were collected from broiler chicks of different hatcheries including 1 to 8 days under Dinajpur District of Bangladesh and aseptically transported with ice box to the bacteriology laboratory, Hajee Mohammad Danesh Science and Technology University for bacterio-logical analysis. The full research period was July - December 2023.

Phenotypic and biochemical characterization of isolates 

According to Azam et al. (2023), bacterial isolates were primarily identified by cultural tests such as Nutrient agar, MacConkey agar, Eosin Methylene agar, Salmonella-Shigella agar, Mannitol salt agar were usually applied for the detection of pure isolates of suspected bacteria from yolk by microscopic (gram staining) and standard biochemical tests such as MR-VP, Indole, Oxidase, Catalase, TSI, Citrate utilization test were used for identification. In this research purpose, all microbiological media were purchased from Hi Media Private Ltd. India.

Molecular identification (DNA extraction and purification) 

According to Riffon et al. (2001), genomic DNA was extracted from selected isolates. Forward primer (5 ATCAACCGAGATTCCCCCAGT 3) and Re-verse primer (5 TCACTATCGGTCAGTCAGGAG 3) were used for detection of 16s rRNA gene of E. coli which in a fragment with about 232 bp length. According to Rahn et al. (1992) Forward primer- (5 GTGAAATTATCGCCACGTTCGGGCAA 3) and Reverse primer- (5 TCATCGCACCGTCAAAGG-AACC 3) were used for detection of invA gene of Salmonella spp. amplified by PCR techniques and final band measure about 284 bp length. According to Riffon et al., (2001), Forward primer Sau-234 and Reverse primer - 1501 were used to detect DNA fragment of Staphylococcus spp. which result in 1267 bp length. According to manufacturer (Max-well-16, source: Promega-USA) guideline, a robotic DNA extractor was applied to extract DNA from E. coli. The purity of E. coli, Salmonella spp., and Staphylococcus spp., DNA was measured by a Nano-drop spectrophotometer (ND-200, source: Thermo Scientific -USA). 1.5% agar gel electrophoresis was used for visualization of PCR band with specific base pair whereas UV-trans illuminator detects photograph of band.

Table 1: PCR Condition for Escherichia coli (Eco 223 and Eco 455).


Table 2: PCR Condition for Salmonella spp. (invA 139 F and invA 141 R).


Table 3: Condition of PCR for Staphylococcus spp. (Sau-234 F and Sau-1501 R).


Evaluating the Antibiotic Susceptibility 

According to Clinical and Laboratory Standards Institute (CLSI) procedure, agar disc diffusion techniques were used to determine the antibiotic sensitivity patterns of isolates on Muller-Hinton agar (CLSI, 2021). A total of 12 commercially available antibiotic discs (Oxoid Limited, UK) such as, Amoxicillin (30 µg), Ampicillin (30 µg), Gentamicin (10 µg), Tetracycline (30 µg), Levofloxacin (5 µg), Co-trimoxazole (30 µg), Cefotaxime (30 µg), Ceftazidime (30 µg), Methicillin (5 µg), Amikacin (30 µg), Azithromycin (30 µg) and Vancomycin (30 µg) were applied for antimicrobial sensitivity test. A pure bacterial colony (0.1 ml) were spread on the Mueller-Hinton agar plate and antibiotic discs were placed on the plates. Then the plates were incubated at 37°C for 16 to 18 hours in standard incubator (BIOBASE, china). After overnight incubation the zones of inhibition was measured by millimeters scale according to (CLSI, 2021) guidelines. All tests were done 3 times for result accuracy.

A. Multidrug Resistance (MDR) Strains Identification

Multidrug resistance bacterial isolates were deter-mined by using disc diffusion method according to (Ezekiel et al., 2011). Multidrug resistance (MDR) was taken as resistant to four or more antibiotics tested.

B. Multiple Antibiotic Resistance (MAR) index determination

According to Saad et al., (2023) the Multiple Anti-biotic Resistance (MAR) index for each strain was determined in which,

MAR index = No. of resistance isolates / Total number of tested antibiotics

MAR index = A/B Where, 

A=No. of resistance isolates; 

B=Total number of tested antibiotics;

C. Disinfectant

Four commercially available disinfectants are used such as, Lysol (Reckitt Benckiser, USA), Virocid (Cid lines, Belgium), FAM 30 (Renata, Bangladesh) and EMSEN (SK+F Eskayef, Bangladesh) were used at 1% concentrations as per recommended dilution. The zone of inhibition was measured in mm on Mueller-Hinton agar with disinfectant against selected isolates.

Statistical Analysis

Statistical analysis was done based on data variables of isolates. Excel version 13 was applied for data analysis as well as standard deviation and standard error measurement.

RESULTS

Frequency of bacterial isolates among chicks based on different categories

The results of incidence of bacteria in chicks are presented in Table 4. From Table 4, out of 24 examined chicks, 17 (70.83%) were found to be positive cases from two different poultry hatcheries with age 1-8 days. The highest number of positive cases were found in day 4, 7 and 8 (100%) followed by 1, 5 and 5 (66.67%) respectively. The positive cases and isolated bacteria were competatively different from two hatcheries with different ages.

Table 4: Incidence of bacteria in chicks from day 1-8 days.


Table 5: Results of Biochemical Tests.


In this current research three bacterial isolates including E. coli, Salmonella spp. and Staphylococcus spp. was isolated from yolk swab samples from suspected omphalitis chicks from different hatcheries in Dinajpur, Bangladesh. From Hatchery 1, 20 isolates were identified including E. coli 6 (30%), Salmonella spp. 4 (20%) and Staphylococcus spp. 10(50%) whereas 8(53.33%) E. coli, 6 (40%) Salmonella spp. and 1 (6.67%) Staphylococcus spp. was found in hatchery 2. Out of 35 bacterial isolates 20 (57.14%) were isolated from hatcheries 1 and 15 (42.86%) were identified from hatchery 2 respectively. The prevalence of bacteria associated with omphalitis is presented in Fig. 1. 

Fig. 1: Prevalence of isolates (E. coli, Salmonella spp. and Staphylococcus spp.) in 1-4 days and 5-8 days old clinically suspected chicks.

Table 6 represents the correlation bacteria and age group of broiler chicks. The bacterial isolates obtained in our study were 14 (40%) E. coli, 10 (28.58%) Salmonella spp. and 11 (31.42%) Staphylococcus spp. from day 1-8 respectively. The highest number of bacteria we isolated from day 5 including 7 (20%), followed by day 3, 4 and 6 including 6 (17.14%) respectively (Table 6). The highest prevalence of isolates is showed in Fig. 2 with standard deviation and standard error value of day 5 omphalitis suspected chicks.

Table 6: Correlation between mortality due to yolk sac infection based on age.



Fig. 2: Prevalence of infection in Day 5 with error bar. 

Molecular detection of isolates by PCR

After confirmation by cultural and biochemical test, E. coli, Salmonella spp., and Staphylococcus spp., were subjected to molecular confirmation. After PCR amplification with specific primers and specific gene E. coli band were detected 232 bp, Salmonella spp., 284 bp and Staphylococcus spp., 1267 bp respectively. The PCR bands are represented in Fig. 3, 4, and 5.

A. Molecular confirmation of isolated E. coli by PCR technique using Eco-223 and Eco-455 primers 


Fig. 3: 16s and 23s RNA genes of E. coli detected by Eco-223 and Eco-455 primers design confirming 232 bp. M: 100 bp DNA Ladder, NC: negative control, Lanes 1-3 field samples. 

B. Molecular confirmation of invA gene of Salmonella spp.


Fig. 4: invA genes of Salmonella spp. detected by invA-139 and invA-141 primers design confirming 284 bp. M: 100 bp DNA Ladder.

C. Molecular confirmation of Sau-234 gene and Sau-1501 gene of Staphylococcus spp. 


Fig. 5:  23S rRNA genes of Staphylococcus aureus detected by Sau – 234 (F) and Sau – 1501 (R) primer design confirming 1267 bp bands, L: Ladder.

Result of antibiotic sensitivity tests

A. Antibiotic sensitivity test by disc diffusion method on Mueller-Hinton agar

Table 7: Antibiotic resistance profile of E. coli.

Table 7 showed that, E. coli was found to be highly resistant to Amoxicillin (100%), followed by Tetracycline (83.33%), Ampicillin (66.67%) whereas highly sensitive to Cefotaxime (100%), Gentamicin and Co-trimoxazole (83.33%) respectively. The analysis of Salmonella spp. sensitivity indicates high susceptibility to, Cefotaxime (83.33), Co-trimoxazole (83.33) and Ceftazidime (83.33%), followed by Gentamicin (66.67%) respectively. However very high resistance of Salmonella spp. was detected to Amoxicillin (100%) and Ampicillin (100%) and to Tetracycline (66.67%) which is presented in Fig. 6.


Fig. 6: Antibiotic resistance profile of Salmonella spp.

The resistance profile of Staphylococcus spp. was found to be highly resistance to Methicillin, Ampicillin (100%) followed by Gentamicin and Tetracycline (83.33%) whereas highly sensitive to Amikacin (100%) which are mentioned in Table 8 respectively. 

Table 8: Antibiotic resistance profile of


spp.


B. Multidrug resistance and MAR index calculation of isolates


Fig. 7: MAR index calculation of E. coli.

Fig. 7, 8 and 9 represented the MAR index calculation of isolated E. coli, Salmonella spp. and Staphylococcus spp. from different source of poultry hatcheries. In Fig. 7, the MAR Index ranged begin from 0.5 to 1.00 and the average MAR index being 0.77 in six isolates.

Fig. 8: MAR index calculation of Salmonella spp.

In Fig. 8, the MAR Index ranged begin from 0.625 to 1.00 and the average MAR index being 0.79 in six isolate In Fig. 9, the MAR Index ranged begin from 0.5 to 1.00 and the average MAR index being 0.77 in six isolates.


Fig. 9: MAR index calculation of Staphylococcus spp.
C. Disinfectant Resistance Profile of Isolates 

Table 9: Zone of inhibition of disinfectant measured in mm on Mueller-Hinton agar.

Four commercially available disinfectants such as Lysol, Virocid, FAM 30 and EMSEN were used at 1% concentrations as per recommended dilution. The zone of inhibition was measured in mm on Mueller-Hinton agar with disinfectant against selected isolates. Table 9 indicated that 1% virocid demonstrated the largest inhibition zone (36 mm) among E. coli followed by, Salmonella spp. 27 mm and Staphylococcus spp. 24 mm respectively. E. coli showed 28 mm zone with 1% Lysol and Staphylococcus spp. showed 22 mm. In 1 % EMSEN disinfectant, 22 mm zone were measured in E. coli

DISCUSSION

It is important to note that bacterial agents play a significant role in hatcheries because they reduce the hatchability rate and impact the health of newly hatched chicks and their future performance. There is a lack of knowledge on the co-resistance of antibiotics and disinfectants in bacteria and antimicrobial resistance.

In the current study, a bacteriological examination of 24 different yolk swab samples from different hatcheries revealed that the recovered isolates E. coli 14 (40%), Salmonella spp. 10 (28.58%) and Staphylococcus spp. 11(31.42%), respectively. Our findings agree with the results of many scientists (Al-Khalaf et al., 2010; Kirunda et al., 2010; Azmy, 2010) who could identify similar isolates from omphalitis-suspected chicks. Moreover, Saad et al. (2023) identified bacterial isolates that contaminated hatchery chicks, includes E. coli, Salmonella spp., Staphylococcus spp., Proteus spp., Pseudomonas spp. Similarly, Alfifi et al. (2022) recorded the highest prevalence of E. coli, 45.8%, which is more or less similar to our findings. Due to climate and geographic differences, heavy contamination of the eggs, and improper handling and storage of hatching eggs, the isolation rate of bacteria may be different.

 According to the results, Multi drug resistant E. coli was found to be highly resistant to Amoxicillin (100%) whereas highly sensitive to Cefotaxime (100%), Gentamicin, and Co-trimoxazole (83.33%); these results agreed with Ahmed, (2016) and Abdel-Tawab et al., (2016). Salmonella spp. were sensitive to Ceftazidime, Co-trimoxazole, and Cefotaxime (83.33%). In comparison, it is highly resistant to Ampicillin and Amoxicillin (100%), and the findings agreed with Ahmed et al., (2011) and Ashraf et al., (2016) - consequently, Staphylococcus spp. Obtained resistance to Methicillin and Ampicillin (100%) whereas sensitive to Amikacin (83.33%), these results were similar to Eid et al. (2015) who observed in their research that Staphylococcus spp. were sensitive to Ciprofloxacin (73.30%). Similarly, Ahmed, (2016) and Abdel-Tawab et al. (2016) obtained Staphylococcus spp. were sensitive to Gentamicin 80%, whereas our findings were 100% resistant.

According to Adenaike et al. (2016), a MAR index of 0.2 or higher indicates a high-risk source of contamination, and a MAR index of 0.4 or higher is associated with human fecal sources of contamination. In this study, 40% of E. coli having a MAR index of 0.77, and 28.58% of Salmonella spp. having a MAR index of 0.79, while Staphylococcus spp. having 0.77. Regarding the molecular detection of virulence genes, PCR techniques were applied to detect and amplify Eco-223, Eco-445 gene, invA gene, and 23S rRNA genes. The PCR band of E. coli was 232 bp, Salmonella spp. 284 bp and Staphylococcus spp. 1167 bp was found by earlier researchers by Shahat et al. (2019). According to Naem et al., (2023), several disinfectants were applied to detect disinfectant resistance isolates, including E. coli, Salmonella spp., and Staphylococcus spp. However, our study demonstrated that E. coli was highly sensitive to 1% virocid with an inhibition zone (36 mm), followed by Salmonella spp. 27 mm and Staphylococcus spp. 24 mm, respectively.

Multi-drug resistance bacterial isolates from newly hatched poultry chicks are dangerous to public health and animal health. Therefore, it is most important to remove these bacterial contaminants from poultry hatcheries by improving the level of hygiene in chick production in the hatcherys environment. This study suggests effective disinfectants instead of commercial resistance anti-biotics to prevent omphalitis in newly hatched chicks.

CONCLUSION

The occurrence of multi-drug resistance isolates (E. coli, Salmonella spp., Staphylococcus spp.) in broiler chicks with omphalitis may cause alarming issues for humans and animals due to the spread of causal agents from infected chicks. Effective disinfectants and antibiotics will be the best treatment for chicks omphalitis. Antibiotics such as Cefotaxime, Co-trimoxazole, Amikacin and Gentamicin will be the best choice for omphalitis treatment, while disinfectants viroid and Lysol play a crucial role in preventing and controlling the spread of infection in poultry hatcheries. Additionally, poultry farmers should be aware of the use of antibiotics and their activity against pathogens that are responsible for chicks omphalitis. If poultry owners know pathogens and maintain proper hatchery guidelines, the chicks production loss will be reduced. Identifying the specific resistance genes that are responsible for omphalitis is a great challenge for poultry farmers. Therefore, more and more research on chicks omphalitis will be needed in the future for Bang-ladesh to reduce production loss and improve the chicks quality.

ACKNOWLEDGEMENT

The bacteriological analysis for study was supported by Bacteriology laboratory, Department of Micro-biology, Hajee Mohammad Danesh Science & Technology University, Dinajpur, Bangladesh. The author wants to special thanks to the poultry farm owner for giving their support during collection of samples. Before final publication all authors checked the full manuscript and approved for final submission.

CONFLICTS OF INTEREST

The authors have no conflict of interests. 

Supplemental Materials:

| 4.00 KB

UniversePG does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted UniversePG a non-exclusive, worldwide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

Article References:

  1. Abdel-Tawab, A. A., Nasef, S. A., & Ibrahim, O. A. (2016). Bacteriological and molecular studies on bacteria causing omphalitis in chicks with regard to disinfectant resis-tance. Global Veterinaria, 17(6), 539-545. https://doi.org/10.5829/idosi.gv.2016.539.545 
  2. Abdel-Tawab, A. A., Nasef, S. A., & Ibrahim, O. A. (2016). Bacteriological and molecular studies on bacteria causing omphalitis in chicks with regard to disinfectant resistance. Global Veterinaria, 17(6), 539-545. https://doi.org/10.5829/idosi.gv.2016.539.545  
  3. Adenaike, O., Olonitola, O. S., Ameh, J. B., & Whong, C. M. Z. (2016). Multidrug resistance and multiple antibiotic resistance index of Escherichia coli strains isolated from retailed smoked fish. Journal of Natural Sciences Research, 6(9), 18-27.
  4. Ahmed. M.M., Rahman, M. M., Mahbub, K. R. and M. Wahid uzzaman, M. (2011). Characterization of Antibiotic-Resistant Sal-monella spp. Isolated from Chicken Eggs of Dhaka City. Journal of Science and Research, 3(1), 191-196.  https://doi.org/10.3329/jsr.v3i1.6109  
  5. Al-Khalaf, A.N.; Akeila, M.A.; Al-Dubaib, M.A.; Azzam, A.H.; El-Shafey, A.A. and Draz.A.A. (2010). Bacterial contamination of hatcheries. Journal of Agricultural and Vete-rinary Sciences, 2(2), 67–76.
  6. Alfifi, A., Christensen, J. P., Hounmanou, Y. M. G., Sandberg, M., & Dalsgaard, A. (2022).Characterization of Escherichia coli and other bacteria isolated from condemned broilers at a Danish abattoir. Frontiers in Microbiology, 13, 1020586. https://doi.org/10.3389/fmicb.2022.1020586       
  7. Aryani, G.A.D. and Jember, I.M. (2019). Analysis of the factors that influence the demand for broiler meat in the province of Bali. E J. EP Unud., 8(5), 1062–1091. 
  8. Azam, M. R., Hosen, M. A., Shil, L. K., Das, N. K., Rumi, N. A., & Hossain, M. K. (2023). Detection of Zoonotic Potential of Salmonella and Escherichia coli Isolated from Ostriches and Determine Their Antibiogram Study. Am. J. Pure Appl. Sci., 5(4), 56-64. https://doi.org/10.34104/ajpab.023.056064 
  9. Azmy R. W. (2010). Some studies on bacterial agents causing embryonic mortalities in chickens and ducks. Department of Avian and Rabbit Medicine Faculty of Veterinary Medicine, Zagazig University. Pp 80-84.
  10. Eid, S., A NASEF, S. O. A. D., & M ERFAN, A. H. M. E. D. (2015). Multidrug resistant bacterial pathogens in eggs collected from backyard chickens. Assiut Veterinary Medical Journal, 61(144), 87-103. https://doi.org/10.21608/avmj.2015.170025  
  11. Ezekiel, C. N., Olarinmoye, A. O., Oyinloye, J. M. A., Olaoye, O. B., & Edun, A. O. (2011). Distribution, antibiogram and multidrug resistance in Enterobacteriaceae from commercial poultry feeds in Nigeria. African journal microbiology research, 5(3), 294-301. https://doi.org/10.5897/AJMR10.848 
  12. Ibrahim, W. A., Marouf, S. A., Erfan, A. M., Nasef, S. A., & El Jakee, J. K. (2019). The occurrence of disinfectant and antibiotic-resistant genes in Escherichia coli isolated from chickens in Egypt. Veterinary World, 12(1), 141-145. https://doi.org/10.14202/vetworld.2019.141-145  
  13. Kirunda, H.; Muwereza, N.; Kasaija, P.D.; Kerfua, S.D. and Kumonyol, K. (2010). Infectious and non-infectious factors affecting hatchability in indigenous chickens in Eastern Uganda. Africa Journal of Animal and Bio-chemical Sciences 5(3), 51–59
  14. Kralik, G., Kralik, Z., Grčević, M. and Hanžek, D. (2018). Quality of chicken meat. In: Animal Husbandry and Nutrition. Intech Open, London. https://doi.org/10.5772/intechopen.72865 
  15. Naem, N. A., Garamoun, S. E., & Yonis, A. E. (2023). Virulence of some Pathogenic Bacteria Isolated from Broiler Chicks up to Two Weeks of Age. Journal of Advanced Veterinary Research, 13(5), 753-760.
  16. Rahman MA, Ahmad T, Mahmud S, Uddin ME, and Ahmed R. (2019). Isolation, identification and antibiotic sensitivity pattern of Salmonella spp. from locally isolated egg samples, Am. J. Pure Appl. Sci., 1(1), 1-11. https://doi.org/10.34104/ajpab.019.019111
  17. Rahn, K., De Grandis, S. A., McEwen, S. A., & Gyles, C. L. (1992). Amplification of an invA gene sequence of Salmonella typhi-murium by polymerase chain reaction as a specific method of detection of Salmonella. Molecular and cellular probes, 6(4), 271-279.
  18. Riffon, R., Khalil, H., Dubreuil, P., Drolet, M., & Lagacé, J. (2001). Development of a rapid and sensitive test for identification of major pathogens in bovine mastitis by PCR. Journal of clinical microbiology, 39(7), 2584-2589. https://doi.org/10.1128/jcm.39.7.2584-2589.2001 
  19. Saad, N., El-Abasy, M. A., El-Khayat, F., Ali, N. G., & Ismail, M. M. (2023). Efficacy of Chitosan Nanoparticles as a Natural Anti-bacterial Agent against Pathogenic Bacteria causing Omphalitis in Poultry. Pakistan Veterinary Journal, 43(3). https://doi.org/10.29261/pakvetj/2023.065  
  20. Shahen MZ, Mahmud S, Uddin ME and Alam MS. (2019). Effect of antibiotic susceptibility and inhibitory activity for the control of growth and survival of microorganisms of extracts of C. officinalis, Eur. J. Med. Health Sci. 1(1), 1-9. https://doi.org/10.34104/ejmhs.0190109 
  21. Shahat, H. S., Mohamed, H., Al-Azeem, A., Mohammed, W., & Nasef, S. A. (2019). Molecular detection of some virulence genes in Pseudomonas aeruginosa isolated from chic-ken embryos and broilers with regard to disinfectant resistance. SVU-International J. of Veterinary Sciences, 2(2), 52-70. https://doi.org/10.21608/svu.2019.12365.1011  
  22. Wibisono, F. J., Effendi, M. H., & Wibisono, F. M. (2022). Occurrence, antimicrobial resistance, and potential zoonosis risk of avian pathogenic Escherichia coli in Indonesia: A review. Intern. J. of One Health, 8(2), 76-85. https://doi.org/10.14202/IJOH.2022.76-85 

Article Info:

Academic Editor

Md. Ekhlas Uddin, Department of Biochemistry and Molecular Biology, Gono Bishwabidalay, Dhaka, Bangladesh.

Received

April 13, 2024

Accepted

April 20, 2024

Published

May 2, 2024

Article DOI: 10.34104/ajpab.024.073083

Corresponding author

Nazmi Ara Rumi*

Associate Professor,Department of Microbiology, Faculty of Veterinary and Animal Science,Hajee Mohammad Danesh Science & Technology University, Dinajpur-5200, Bangladesh.

Cite this article

Hasan MT, Sany ZA, Mansur S, Ahmed MF, Maksud FA, Khatun S, Rumi NA, Afroz F, and Hosen MA. (2024). Isolation and molecular detection of bacteria causing Omphalitis in poultry with look on antibiotic and disinfectant resistance. Am. J. Pure Appl. Sci., 6(3), 73-83. https://doi.org/10.34104/ajpab.024.073083

Views
1250
Download
209
Citations
Badge Img
Share